View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18401_high_18 (Length: 252)
Name: NF18401_high_18
Description: NF18401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18401_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 33382307 - 33382533
Alignment:
| Q |
17 |
tgtatggccacaaagttgttacaagagccactagagcaactactacttgagcaacatccagattgtgttgtttctgacacgtttttcgcatggacaactg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33382307 |
tgtatggccacaaagttgttacaagagccacttgagcaactactacttgagcaacatccagattgtgttgtttctgacacgtttttcgcatggacaactg |
33382406 |
T |
|
| Q |
117 |
attcagctgctaaatttggaattcctagacttgtgtttcatggtacttgtttcttctccttgtgtgctgtagagtgtatgagactctatgaacctttcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33382407 |
attcagctgctaaatttggaattcctagacttgtgtttcatggtacttgtttcttctccttgtgtgctgtagagtgtatgagactc--tgaacctttcaa |
33382504 |
T |
|
| Q |
217 |
gaatgtttcttttgattcagaaccctttg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33382505 |
gaatgtttcttttgattcagaaccctttg |
33382533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 78 - 184
Target Start/End: Complemental strand, 27689467 - 27689361
Alignment:
| Q |
78 |
attgtgttgtttctgacacgtttttcgcatggacaactgattcagctgctaaatttggaattcctagacttgtgtttcatggtacttgtttcttctcctt |
177 |
Q |
| |
|
||||||||||| |||| | ||| || ||||| |||| ||||| ||||| ||||||||||||||||| ||||||| ||||| ||| ||||||| || || |
|
|
| T |
27689467 |
attgtgttgttgctgatatgttctttccatgggcaaccgattcggctgcaaaatttggaattcctaggattgtgttccatggcactagtttcttttcatt |
27689368 |
T |
|
| Q |
178 |
gtgtgct |
184 |
Q |
| |
|
||||||| |
|
|
| T |
27689367 |
gtgtgct |
27689361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University