View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18401_high_25 (Length: 227)
Name: NF18401_high_25
Description: NF18401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18401_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 39365572 - 39365355
Alignment:
| Q |
1 |
gtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtacctt---------attttgtacattttcatcttcct |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39365572 |
gtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtaccttcgtttgcttattttgtacattttcatcttcct |
39365473 |
T |
|
| Q |
92 |
tccaagcataaggtaatagtgatcatatgattttttgtatgtatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaaggtgacggtgaat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365472 |
tccaagcataaggtaatagtgatcatatgattttttgtatttatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaaggtgacggtgaat |
39365373 |
T |
|
| Q |
192 |
ggttttgctgatcagaag |
209 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39365372 |
ggttttgctgatcagaag |
39365355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University