View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18401_low_22 (Length: 252)

Name: NF18401_low_22
Description: NF18401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18401_low_22
NF18401_low_22
[»] chr7 (1 HSPs)
chr7 (1-243)||(46557395-46557640)


Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 46557395 - 46557640
Alignment:
1 gtaattgttgttcttctggtggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46557395 gtaattgttgttcttctggtggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaac 46557494  T
101 aagagcgatgtttagaaagagaaagagaggaggttactaattaagaaca---aggctttaaggttaattttggtatataaaaggtgatcacgaagaagaa 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||    
46557495 aagagcgatgtttagaaagagaaagagaggaggttactaattaagaacaaggaggctttaaggttaattttggtatataaaaggtgatcacgaagaagaa 46557594  T
198 tgggaggagaatatcgttagaaattcctagatctttccagaataat 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
46557595 tgggaggagaatatcgttagaaattcctagatctttccagaataat 46557640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University