View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18401_low_24 (Length: 239)
Name: NF18401_low_24
Description: NF18401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18401_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 9069304 - 9069084
Alignment:
| Q |
3 |
actaacattatatatgatcatctttgtaagtttatgagcaaccatattaccctaaaaaacttgatgtaagatctattgcaataaaataataacaagattc |
102 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9069304 |
actaacattatatataatcatcttcgtaagtttatgagcaaccatattaccctaaaaaacttgatgtaagatctattgcaataaaataataacaagattc |
9069205 |
T |
|
| Q |
103 |
gacaactattcaaaatggataatatttatgagttgtcttgagctgaagaattgaaaaggtgaactacttctttgaaaacaaattatgaaaacacaattct |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9069204 |
gacaactactcaaaatggataatatttatgagttgtcttgagctgaagaattgaaaaggtggactacttctttgaaaacaacttatgaaaacacaattct |
9069105 |
T |
|
| Q |
203 |
ctcctccactctagtgcttct |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9069104 |
ctcctccactctagtgcttct |
9069084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University