View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18401_low_27 (Length: 230)
Name: NF18401_low_27
Description: NF18401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18401_low_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 2 - 230
Target Start/End: Complemental strand, 2582270 - 2582042
Alignment:
| Q |
2 |
taccttgtcactccgagtgtttaactaatattttcaatagaaaactgttttcttttatttttcctaaaatttgtgtgattattgaattcggcaaacgccc |
101 |
Q |
| |
|
||||| ||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2582270 |
tacctcgtcacacggagtgtttgactaatattttcaatagaaaactgttttcttttatttttcctaaaatttgtgtgattattgaattcggcaaacgccc |
2582171 |
T |
 |
| Q |
102 |
tctcaaatctggtggtttacaacagtgtaaatggatccttaggtgttcataaaaaagtggaagttgtaacaaaaatggatccctaataatgaacaggtct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2582170 |
tctcaaatctggtggtttacaacagtgtaaatggatccttaggtgttcataaaaaagtggaagttgtaacaaaaatggatccctaataatgaacaggtct |
2582071 |
T |
 |
| Q |
202 |
ggttctaagatgtttacgtgcatattaac |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2582070 |
ggttctaagatgtttacgtgcatattaac |
2582042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University