View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18402_low_5 (Length: 243)
Name: NF18402_low_5
Description: NF18402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18402_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 36602145 - 36602044
Alignment:
| Q |
7 |
tgagatgaaaggtcagtttgattcaatgttcgcgtctctagtatcaaagtatggtggaagtgatatgccagaaccctctgaagaggaatttgaagctgca |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602145 |
tgagaggaaaggtcagtttgattcaatgttcgcgtctctagtatcaaagtatggtggaagtgatatgccagaaccctctgaagaggaatttgaagctgca |
36602046 |
T |
 |
| Q |
107 |
ca |
108 |
Q |
| |
|
|| |
|
|
| T |
36602045 |
ca |
36602044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 172 - 227
Target Start/End: Complemental strand, 36601980 - 36601925
Alignment:
| Q |
172 |
atactattatgtatatagctactttatttgtgtgaagtgtgagaacatggcattag |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36601980 |
atactattatgtgtatagctactttatttgggtgaagtgtgagaacatggcattag |
36601925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 20992878 - 20992959
Alignment:
| Q |
22 |
gtttgattcaatgttcgcgtctctagtatcaaagtatggtggaagtgatatgccagaaccctctgaagaggaatttgaagct |
103 |
Q |
| |
|
||||||||| |||||| |||||||| ||||||| ||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
20992878 |
gtttgattctatgttctcgtctctaatatcaaaatatggtggaagccatgtgccagaaccctctgaagaggaatttgaagct |
20992959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University