View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18403_high_18 (Length: 261)
Name: NF18403_high_18
Description: NF18403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18403_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 251
Target Start/End: Complemental strand, 10333201 - 10332970
Alignment:
| Q |
20 |
ttcaatatcttgaactttgcttccagtcaacataaaatcatccacatacaagcatacgataagtaaactagtctcttctcttccttttacatacactcca |
119 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10333201 |
ttcaatatcttgaatttatcttccagtcaacataaaatcatccacatacaagcatacgataagtaaactagtctcttctcttccttttacatacactcca |
10333102 |
T |
 |
| Q |
120 |
tgctcaacaatgcatttcttaaatccttctttcttaaagcatttgtcaannnnnnnattctaggccctaggttctcatttcaagctatatagagccttgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10333101 |
tgctcaacaatgcatttcttaaatccttctttcttaaagcatttgtcaatttttttattctaggccctaggttctcatttcaagctatatagagccttgt |
10333002 |
T |
 |
| Q |
220 |
ttagtttgaacactctatcttctttccctttg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10333001 |
ttagtttgaacactctatcttctttccctttg |
10332970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University