View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18403_high_7 (Length: 418)
Name: NF18403_high_7
Description: NF18403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18403_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 41 - 180
Target Start/End: Complemental strand, 30835475 - 30835336
Alignment:
| Q |
41 |
ttaaagaacaaatgctaattaataaattggtaatctaatgtgattgaaactatttagctaatgtagtgtatgttttacggtcgcagactagccaacaaat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
30835475 |
ttaaagaacaaatgctaattaataaattggtaatgtaatgtgattgaaactatttagctaatgtagtgtatgttttacagttgcagactagccaacaaat |
30835376 |
T |
|
| Q |
141 |
ggattttgaatgattatagtgcccttttgatgcttgcttg |
180 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
30835375 |
ggattttgaatgattacagggccctgttgatgcttgcttg |
30835336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 108; Significance: 4e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 41 - 180
Target Start/End: Complemental strand, 3192247 - 3192108
Alignment:
| Q |
41 |
ttaaagaacaaatgctaattaataaattggtaatctaatgtgattgaaactatttagctaatgtagtgtatgttttacggtcgcagactagccaacaaat |
140 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
3192247 |
ttaaagaacaaaggctaattaataaattggtaatgtaatgagattgaaactatttagctaatgtagtgtatgttttacagttgcagactagccaacaaat |
3192148 |
T |
|
| Q |
141 |
ggattttgaatgattatagtgcccttttgatgcttgcttg |
180 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
3192147 |
ggattttgaatgattacagggccctgttgatgcttgcttg |
3192108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University