View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18403_low_15 (Length: 290)
Name: NF18403_low_15
Description: NF18403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18403_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 88 - 283
Target Start/End: Complemental strand, 6169189 - 6168996
Alignment:
| Q |
88 |
ttgtttagtttctaaacttttgtctcaaaggttcccctaaagataattctaattccacgttgacaaacttaggatttgtatttatcaaaagcttcttcat |
187 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
6169189 |
ttgtttagtttctaaactttggtctcaaaggttcctctaaagataattctaattccacgttgacaaacttaggatttgt--ttatcaaaagtttcttcat |
6169092 |
T |
 |
| Q |
188 |
aattatttatcacaaactaatacgattttagaggtgtccttgcataatcttcttttctataggtttgtttgatcttatttcttattattgcctttg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169091 |
aattatttatcacaaactaatacgattttagaggtgtccttgcataatcttcttttctttaggtttgtttgatcttatttcttattattgcctttg |
6168996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University