View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18403_low_25 (Length: 234)
Name: NF18403_low_25
Description: NF18403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18403_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 42759698 - 42759627
Alignment:
| Q |
17 |
actttcctcaatcttagcagttaaacttggtgtgcatggagctgtgatttgctggagttaatttgatggtcg |
88 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42759698 |
actttcttcaatcttagcagttaaacttggtgtgcatggagctgtgatttgctggagttaatttgatggtcg |
42759627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 148 - 219
Target Start/End: Complemental strand, 42759505 - 42759433
Alignment:
| Q |
148 |
gactatttctgtttaatt-aagtatccagtttcatttcaattccatttatatttttccctaagtaattctctg |
219 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42759505 |
gactatttctgtttaatttaagtatctagtttcatttcaattccatttatatttttccctaagtaattctctg |
42759433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 148 - 219
Target Start/End: Original strand, 1402329 - 1402400
Alignment:
| Q |
148 |
gactatttctgtttaattaagtatccagtttcatttcaattccatttatatttttccctaagtaattctctg |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1402329 |
gactatatctgtttaattaagtatccagtttcatttcaattccatttatattttgccctaagtaattctctg |
1402400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 17 - 75
Target Start/End: Original strand, 1402150 - 1402208
Alignment:
| Q |
17 |
actttcctcaatcttagcagttaaacttggtgtgcatggagctgtgatttgctggagtt |
75 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1402150 |
actttcttcaatcttagcagttaaacttggtgtgcatggagctgtgatttgctggagtt |
1402208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University