View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18403_low_26 (Length: 225)

Name: NF18403_low_26
Description: NF18403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18403_low_26
NF18403_low_26
[»] chr3 (1 HSPs)
chr3 (11-208)||(36570466-36570663)


Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 208
Target Start/End: Complemental strand, 36570663 - 36570466
Alignment:
11 aagcaaaggaaggtactaaactaattcattcatccattcatttcgattttcttgttgcaatgtaattaataacaacatgtttgtgtttgtggcaaacagt 110  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36570663 aagcaaagaaaggtactaaactaattcattcatccattcatttcgattttcttgttgcaatgtaattaataacaacatgtttgtgtttgtggcaaacagt 36570564  T
111 ggttggaatcataaaactggctcttgaagctggaaaggcgacgccggcaccaccagttggaccggctcttggttcaaagggtgttaacattatggctt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36570563 ggttggaatcataaaactggctcttgaagctggaaaggcgacgccggcaccaccagttggaccggctcttggttcaaagggtgttaacattatggctt 36570466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University