View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_102 (Length: 299)
Name: NF18404_high_102
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_102 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 44262308 - 44262020
Alignment:
| Q |
1 |
ttagcttatgttgcaacactttttcatcaccattgtcaaaatccatggaaaatctcaccacactgaacattttttagataagcaataatttcactattgg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262308 |
ttagcttctgttgcaacactttttcatcaccattgtcaaaatccatggaaaatctcaccacactgaacattttttagataagcaataatttcactattgg |
44262209 |
T |
 |
| Q |
101 |
aaggtcaaggatacttacaaccttaaatgcatccatcccgaggagcttggaagttccacttccttatagacgcctcgactagatgttcttgagccatgga |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262208 |
aaggtcagggatacttacaaccttaaatgcatccatcccaaggagcttggaagttccacttccttatagacgcctcgactagatgttcttgagccatgga |
44262109 |
T |
 |
| Q |
201 |
acatccaatttactctggagagattaaagaaactcttggcagccaaggaaatctcacaacattgatacttttcaatattgctttctctg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262108 |
acatccaatttactctggagagattaaagaaactcttggcagccaaggaaatctcacaacattgatacttttcaatattgctttctctg |
44262020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University