View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_103 (Length: 298)
Name: NF18404_high_103
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_103 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 10306117 - 10305825
Alignment:
| Q |
1 |
ttttcattttcaacattaacatcaatattaacattggtgtcatatttttcagg--tgatattg----cattgcatggtgcagtgaccctatttttgatat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || || | |||||| |||| |||||| | |||||||||||||||| |
|
|
| T |
10306117 |
ttttcattttcaacattaacatcaatattaacattggtgtcattttcagcaacattaatattggtgtcattttcaggtgcaataaccctatttttgatat |
10306018 |
T |
 |
| Q |
95 |
gaagaaaatttgagggtttggttgtgagagtagtagtagtgttgtgagtgatgaattttttggtttgaaaatggannnnnnnatggactaggatgtttgg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10306017 |
gaagaaaatttgagggtttggttgtgagagtagtagt---gttgtgagtgatgaattttttggtttgaaaatggatttttttatggactaggatgtttgg |
10305921 |
T |
 |
| Q |
195 |
ttttggatatgtgaggtttttgtggagatgatgaagatgttgttgttgcatgttggtggaaatttttgtgtgaataggaacaagtgaatgatgatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10305920 |
ttttggatatgtgaggtttttgtggagatgatgaagatgttgttgttgcatgttggtggaaatttttgtgtgaataggaacaagtgaatgatgatg |
10305825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University