View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18404_high_107 (Length: 291)

Name: NF18404_high_107
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18404_high_107
NF18404_high_107
[»] chr4 (18 HSPs)
chr4 (18-283)||(2621028-2621293)
chr4 (21-178)||(2367648-2367805)
chr4 (23-148)||(2486239-2486364)
chr4 (36-131)||(5106333-5106428)
chr4 (25-146)||(2547466-2547587)
chr4 (18-131)||(5102106-5102219)
chr4 (37-158)||(12124770-12124891)
chr4 (34-134)||(2472035-2472135)
chr4 (25-148)||(2491062-2491185)
chr4 (19-74)||(2382562-2382617)
chr4 (37-131)||(2519179-2519273)
chr4 (34-148)||(2525700-2525814)
chr4 (37-178)||(2373212-2373352)
chr4 (19-119)||(2391036-2391136)
chr4 (29-148)||(2467468-2467587)
chr4 (103-145)||(1517029-1517071)
chr4 (19-148)||(5035550-5035679)
chr4 (63-151)||(12126852-12126940)
[»] chr7 (1 HSPs)
chr7 (34-131)||(2576415-2576512)
[»] chr1 (1 HSPs)
chr1 (34-134)||(15837979-15838079)
[»] chr5 (1 HSPs)
chr5 (103-159)||(12846948-12847004)


Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 18)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 2621293 - 2621028
Alignment:
18 gttgagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2621293 gttgagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatg 2621194  T
118 gacaaaaactgtttggacacgagggagagaggttccaagtaatggttgttgtcgccgtcgtcaactaacttgaagatacactcccaccactcctctggta 217  Q
    ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
2621193 gacaaaaactgtttggatacgagggagagaggttcccagtaatggttgttgtcgccatcgtcaactaacttgaagatacactcccaccactcctctggta 2621094  T
218 agaatgaacatgtttccgccattgtttttggaatattgaatgtcaatgattatgataatgatgatg 283  Q
    ||||||||||||||||||||||||||| |||||||||| |||||||| | ||||| ||||||||||    
2621093 agaatgaacatgtttccgccattgtttgtggaatattggatgtcaataactatgacaatgatgatg 2621028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 21 - 178
Target Start/End: Complemental strand, 2367805 - 2367648
Alignment:
21 gagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggac 120  Q
    |||||||||||  || |||||||| | ||| ||||||  || ||||||||| ||||||||||| ||||  |||||||| || |||||||||||||||||     
2367805 gagggatgtgaggttggggaacctttggaaaaggcgataaaggaaagggattgttttatcggacattgctatggagaatcggagacggttggtgatggag 2367706  T
121 aaaaactgtttggacacgagggagagaggttccaagtaatggttgttgtcgccgtcgt 178  Q
    | ||| |||||||| |||| ||| ||||||||||||||  |||||||||||| |||||    
2367705 agaaattgtttggagacgatggaaagaggttccaagtagcggttgttgtcgctgtcgt 2367648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 23 - 148
Target Start/End: Original strand, 2486239 - 2486364
Alignment:
23 gggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaa 122  Q
    ||||||| | |||||||||||  |  ||||| ||| ||| ||||||||| ||||| |||||||||||||  ||||| || |||||||||||||||||||     
2486239 gggatgtaacattagggaacccataaaagagacgatgaaggaaagggattgttttctcggagattgtgaccgagaatcggagacggttggtgatggacag 2486338  T
123 aaactgtttggacacgagggagagag 148  Q
    ||||||||| || |||||||||||||    
2486339 aaactgttttgagacgagggagagag 2486364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 36 - 131
Target Start/End: Complemental strand, 5106428 - 5106333
Alignment:
36 agggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgttt 131  Q
    ||||||||| | |||||||||| |||||||||||||||||| ||  | ||||||||  ||||| ||  ||||||||||||||||||||||||||||    
5106428 agggaaccttttgaagaggcgatgaatgaaagggatggtttgattagtgattgtgaccgagaatcgaggacggttggtgatggacaaaaactgttt 5106333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 25 - 146
Target Start/End: Original strand, 2547466 - 2547587
Alignment:
25 gatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaa 124  Q
    |||||||| ||||||||||| | ||||| | |||||| | || ||||| | | |  |||||||||||  |||||||| ||||||||||||||||||| ||    
2547466 gatgtgatgttagggaacctttggaagaagtgaggaagggaaaggatgatatgactggagattgtgactgagaaccggagacggttggtgatggacagaa 2547565  T
125 actgtttggacacgagggagag 146  Q
    |||||||||| |||| ||||||    
2547566 actgtttggagacgatggagag 2547587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 5102219 - 5102106
Alignment:
18 gttgagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatg 117  Q
    |||||| |||||||  ||||||||||| ||||| ||| ||||||||||||||||||||  ||| | ||||||||  ||||| || ||||  || |||||     
5102219 gttgagtgatgtgacgttagggaacctttcgaaaaggagaggaatgaaagggatggttcgatcagtgattgtgaccgagaatcgaagactattagtgata 5102120  T
118 gacaaaaactgttt 131  Q
    ||||||||||||||    
5102119 gacaaaaactgttt 5102106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 37 - 158
Target Start/End: Original strand, 12124770 - 12124891
Alignment:
37 gggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgtttggaca 136  Q
    |||||||| | |||||||||   || ||||||||| |||| ||| ||||||| |||||| ||  | ||||||||||||||||| | ||| |||||||| |    
12124770 gggaacctttggaagaggcggtcaaggaaagggattgtttcatcagagattgcgatggaaaattggagacggttggtgatggagagaaattgtttggaga 12124869  T
137 cgagggagagaggttccaagta 158  Q
    | | ||||||||||||||||||    
12124870 caatggagagaggttccaagta 12124891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 34 - 134
Target Start/End: Original strand, 2472035 - 2472135
Alignment:
34 ttagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgtttgg 133  Q
    ||||||||||| ||||||||| || ||| ||||||||| |||| |  | ||||||||| |||||| |  ||||| ||||||||||| |||||||||||||    
2472035 ttagggaacctttcgaagaggtgatgaaggaaagggattgtttcacagtagattgtgagggagaatcagagacgattggtgatggagaaaaactgtttgg 2472134  T
134 a 134  Q
    |    
2472135 a 2472135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 25 - 148
Target Start/End: Original strand, 2491062 - 2491185
Alignment:
25 gatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaa 124  Q
    ||||| || ||||||||||| || ||||| |||  || ||||||||| |||  ||||||||||||||  || || || |||||||| |||||||||| ||    
2491062 gatgtaatgttagggaacctttcaaagagacgattaaggaaagggattgttgcatcggagattgtgaccgaaaatcggagacggtttgtgatggacagaa 2491161  T
125 actgtttggacacgagggagagag 148  Q
    ||||||| || ||||| |||||||    
2491162 actgttttgagacgagtgagagag 2491185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 2382617 - 2382562
Alignment:
19 ttgagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggt 74  Q
    ||||||||||||| |||||||| |||   |||||||||||||||||||||||||||    
2382617 ttgagggatgtgacattagggagccttcggaagaggcgaggaatgaaagggatggt 2382562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 131
Target Start/End: Original strand, 2519179 - 2519273
Alignment:
37 gggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgttt 131  Q
    |||||||| || ||||| ||| ||| ||||||||| |||| ||| ||||||||||  ||| | || | ||||||||||||||||| |||||||||    
2519179 gggaacctatcaaagagacgatgaaggaaagggattgtttgatctgagattgtgactgaggatcgaaaacggttggtgatggacagaaactgttt 2519273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 34 - 148
Target Start/End: Original strand, 2525700 - 2525814
Alignment:
34 ttagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgtttgg 133  Q
    ||||||||||| || ||||| |||  ||  |||||||| |||  || |||||||||||   |||| || |||| |||||||||||||| ||||||||| |    
2525700 ttagggaacctttcaaagagacgattaagaaaagggatagttgcattggagattgtgaccaagaatcgaagactgttggtgatggacagaaactgttttg 2525799  T
134 acacgagggagagag 148  Q
    | |||||||||||||    
2525800 agacgagggagagag 2525814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 37 - 178
Target Start/End: Complemental strand, 2373352 - 2373212
Alignment:
37 gggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgtttggaca 136  Q
    |||||||| | ||||||||||  || |||||| || ||||||||| | ||||  |||||||| || ||| | ||||||||||| | ||| |||||||| |    
2373352 gggaacctttggaagaggcgattaaggaaaggaattgttttatcg-acattgctatggagaatcggagatgattggtgatggagagaaattgtttggaaa 2373254  T
137 cgagggagagaggttccaagtaatggttgttgtcgccgtcgt 178  Q
    | | |||||||||||| |||||  || |||||| ||||||||    
2373253 caacggagagaggttcgaagtagcggctgttgttgccgtcgt 2373212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 119
Target Start/End: Complemental strand, 2391136 - 2391036
Alignment:
19 ttgagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatgg 118  Q
    ||||||||||||| ||||| |||||  | |||||   |||||||||||||||||||||  | || |||| |||||||||| || |||  |||||||||||    
2391136 ttgagggatgtgacattagagaaccgttggaagatttgaggaatgaaagggatggtttgttgggtgattttgatggagaatcggagattgttggtgatgg 2391037  T
119 a 119  Q
    |    
2391036 a 2391036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 29 - 148
Target Start/End: Original strand, 2467468 - 2467587
Alignment:
29 tgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactg 128  Q
    ||||||| |||||||| || ||||| ||| |||  |||||||| |||   ||||| || | || |||||| || |||| |||||| ||||||||||||||    
2467468 tgatattggggaacctttcaaagagacgatgaagtaaagggattgttccgtcggaaatcgagacggagaatcgaagactgttggtaatggacaaaaactg 2467567  T
129 tttggacacgagggagagag 148  Q
    ||| || |||| ||||||||    
2467568 ttttgagacgacggagagag 2467587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 145
Target Start/End: Complemental strand, 1517071 - 1517029
Alignment:
103 agacggttggtgatggacaaaaactgtttggacacgagggaga 145  Q
    |||||||||||||||||||| || |||||||| ||||||||||    
1517071 agacggttggtgatggacaagaattgtttggaaacgagggaga 1517029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 148
Target Start/End: Original strand, 5035550 - 5035679
Alignment:
19 ttgagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatgg 118  Q
    ||||| ||||| |||||||||||||| || ||||| |||  || ||||||||| |||   || |||||| |||   |||| || ||||||||||||||||    
5035550 ttgagtgatgtaatattagggaacctttcaaagagacgactaaggaaagggattgttgcctcagagattttgaccaagaatcgaagacggttggtgatgg 5035649  T
119 acaaaaactgtttggacacgagggagagag 148  Q
    | | ||||||||| || |||| ||| ||||    
5035650 agagaaactgttttgaaacgaaggaaagag 5035679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 63 - 151
Target Start/End: Original strand, 12126852 - 12126940
Alignment:
63 gaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgtttggacacgagggagagaggtt 151  Q
    |||||||||  ||| ||| |||| || |||||||||  | ||||||||||||||||| | ||| |||||||| || | |||||||||||    
12126852 gaaagggattttttcatctgagactgcgatggagaataggagacggttggtgatggagagaaattgtttggagacaatggagagaggtt 12126940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 34 - 131
Target Start/End: Complemental strand, 2576512 - 2576415
Alignment:
34 ttagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgttt 131  Q
    ||||||| ||| ||||||||||||  ||||||||||||||||  ||||| ||||||||  ||||| || ||||| ||||||||||| |||||||||||    
2576512 ttagggatcctttcgaagaggcgacaaatgaaagggatggttcaatcggtgattgtgaccgagaatcgaagacgattggtgatggataaaaactgttt 2576415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 34 - 134
Target Start/End: Complemental strand, 15838079 - 15837979
Alignment:
34 ttagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggacaaaaactgtttgg 133  Q
    ||||||||||| | |||||||  ||||||||||||||| |||| |||   |||| ||| |||||| || ||||||||||||||||| | |||||||||||    
15838079 ttagggaacctttggaagaggttaggaatgaaagggattgtttgatctatgattttgagggagaatcggagacggttggtgatggagagaaactgtttgg 15837980  T
134 a 134  Q
    |    
15837979 a 15837979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 12846948 - 12847004
Alignment:
103 agacggttggtgatggacaaaaactgtttggacacgagggagagaggttccaagtaa 159  Q
    ||||||||||||||||| |  ||||| ||||| |||||||||||| |||||||||||    
12846948 agacggttggtgatggagaggaactgcttggaaacgagggagagatgttccaagtaa 12847004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University