View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_110 (Length: 285)
Name: NF18404_high_110
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_110 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 3311130 - 3310863
Alignment:
| Q |
1 |
aagagtagtgtctctttcttgacctctcacacacgccacacacaacatgtacaaaaggctgctccatgtccaagcctcatatttgtcatttatgaagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311130 |
aagagtagtgtctctttcttgacctctcacacacgccacacacaacatgtacaaaaggctgctccatgtccaagcctcatatttgtcatttatgaagata |
3311031 |
T |
 |
| Q |
101 |
tttttacagttgaaaaccctctcactcagacctagtttatagttcaatctgcaaaagcagcagcactcatttctcctctctatcctcacatatcaatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| | || |
|
|
| T |
3311030 |
tttttacagttgaaaaccctctcactcagacctagtttatagtgcaatctgcaaaagcagcaacactcatttctcctctctatcctcacatatcagttat |
3310931 |
T |
 |
| Q |
201 |
cag--tttaacgagatctgatgacatgccctatccacgtgttgcatgtctttctctctctgttgagtt |
266 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310930 |
cagtttttaacgagatctgatgacatgccctatccacgtgttgcatgtctttctctctctgttgagtt |
3310863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University