View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_113 (Length: 280)
Name: NF18404_high_113
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_113 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 184630 - 184369
Alignment:
| Q |
1 |
taagattttacgattcaatttcgaattttaactaccatgcatggggagtcggcctcatcagcagattctttccctttctcttccttgatgttgtgggtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
184630 |
taagattttacgattcaatttcgaattttaactaccatgcatgagaagtcggcctcatcagcagattctttccctttctcttccttaatgttgtgggtgt |
184531 |
T |
 |
| Q |
101 |
aaaccttaaactgtcacttgcaagttccctatattcaggggtgactttgacatcaaacgtagtcaatatagtagaattctcctggacgttcttttcaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
184530 |
aaaccttaaactgtcacttgcaagttccctatattcaggggtgactttgacatcaaacgtagtcaatatagtagaattctcctggacgttcttttcaagc |
184431 |
T |
 |
| Q |
201 |
attgcacttgcactggccttcttcacatctttcttatgtacacgacctatagcgctgacagg |
262 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
184430 |
attgctcttgcactggccttcttcacatctttcttatgtacatgatctatagcactgacagg |
184369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 250
Target Start/End: Complemental strand, 3015000 - 3014935
Alignment:
| Q |
189 |
ttcttttcaagcattgcact----tgcactggccttcttcacatctttcttatgtacacgacctat |
250 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| |||||||||| | ||||||| |
|
|
| T |
3015000 |
ttcttttcaagcattgcactggcttgcactggccttctccacatccttcttatgtataggacctat |
3014935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University