View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_122 (Length: 270)
Name: NF18404_high_122
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_122 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 270
Target Start/End: Original strand, 9495941 - 9496200
Alignment:
| Q |
11 |
cacagatgaatttgacaacctctatgtatcagaggaagagtatgactttcatgctgtttctggtatagattataatcaatactttggtggcggtgtaatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9495941 |
cacagatgaatttgacaacctctatgtatcagaggaagagtatgactttcatgctgtttctggtatagattataatcaatactttggtggcggtgtaatg |
9496040 |
T |
|
| Q |
111 |
tactggaacccttctgaaaatccaggaaaaggtttttctcggcctccctctctcagctctgatgacagtttatgggctttgcgtgaagctgacatgaata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496041 |
tactggaacccttctgaaaatccaggaaaaggtttttctcggcctccctctctcagctctgatgacagtttatgggctttgcgtgaagctgacatgaata |
9496140 |
T |
|
| Q |
211 |
ggacagtggatgaaatggttgctttctcttcttcagatagtacaaatggtttagcatctc |
270 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9496141 |
ggacagtggatgatatggttgctttctcttcttcatatagtacaaatggtttagcatctc |
9496200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University