View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_127 (Length: 263)
Name: NF18404_high_127
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_127 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 12372178 - 12371947
Alignment:
| Q |
17 |
aataccgaacctagcaatcccttcttgattgactgaaatacacatggctaacacttataaatcgtgggtcttaatagacttatttagcaagacacaattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12372178 |
aataccgaacctagcaatcccttcttgattgactgaaatacacatggctaacacttataaatcgtgggtcttaatagacttatttagcaagacaca-ttt |
12372080 |
T |
 |
| Q |
117 |
tcaattggtgtgagcaaccccaatcaatttcatctaaaagagagtgtttgagagtgtgtggttaacacttcgtttttgtctcgttgatggattgctggca |
216 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12372079 |
tcaattggtgtgagccacaccaatcaatttcatctaaaagagagtgtttgagagtgtgtggttaacacttcgtttttgtctcgttgatggattgctggca |
12371980 |
T |
 |
| Q |
217 |
gttaattattgtaaaatattttgagtgattgtt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12371979 |
gttaattattgtaaaatattttgagtgattgtt |
12371947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University