View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_129 (Length: 261)
Name: NF18404_high_129
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_129 |
 |  |
|
| [»] scaffold0290 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 80 - 245
Target Start/End: Complemental strand, 14098331 - 14098166
Alignment:
| Q |
80 |
ctaaaatcattgaggtcctgtggcagccaccaatatttcattggataaaatgcaacaccgacggatctgctaatgatattacctcctcttgtggtggcat |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14098331 |
ctaaaatcattgaggtcctatggcagccaccaatatttcattggataaaatgcaacaccgacggatctgctaatgatattacctcctcttgtggtggcat |
14098232 |
T |
 |
| Q |
180 |
attcagagataaagactcaaaattcatcttatgctttgctgagaatacaggtatagggaactctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14098231 |
attcagagataaagactcaaaattcatcttatgctttgctgagaatacaggtatagggaactctct |
14098166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 80 - 241
Target Start/End: Complemental strand, 21238774 - 21238614
Alignment:
| Q |
80 |
ctaaaatcattgaggtcctgtggcagccaccaatatttcattggataaaatgcaacaccgacggatctgctaatgatattacctcctcttgtggtggcat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
21238774 |
ctaaaatcattgaggtcctgtggcagccaccaatatttcattggataaaatgcaacaccgacggatctgctaataatattacttcctcttgtggtggcat |
21238675 |
T |
 |
| Q |
180 |
attcagagataaagactcaaaattcatcttatgctttgctgagaatacaggtatagggaact |
241 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21238674 |
attaagagat-aagactcaaaattcatcttatgctttgctgagaatacaggtatagggaact |
21238614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 18894281 - 18894325
Alignment:
| Q |
18 |
atcatcaacagatagggaaatgggattattctcccatagatttta |
62 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
18894281 |
atcaccaaccgatagggaaatgggattattcgcccttagatttta |
18894325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: scaffold0290
Description:
Target: scaffold0290; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 119 - 245
Target Start/End: Complemental strand, 10616 - 10490
Alignment:
| Q |
119 |
attggataaaatgcaacaccgacggatctgctaatgatattacctcctcttgtggtggcatattcagagataaagactcaaaattcatcttatgctttgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10616 |
attggataaaatgcaacaccgacggatctgctaatgatattacctcctcttgtggtggcatattcagagataaagactcaaaattcatcttatgctttgc |
10517 |
T |
 |
| Q |
219 |
tgagaatacaggtatagggaactctct |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10516 |
tgagaatacaggtatagggaactctct |
10490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 16697366 - 16697443
Alignment:
| Q |
1 |
ctatctttatgcattttatcatcaacagatagggaaatgggattattctcccatagattttatcaatacgaaggagct |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16697366 |
ctatctttatgcattttatcaccaacagatagagaaatgggattattctcccatagattttatcaatacaaaggagct |
16697443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University