View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_135 (Length: 252)
Name: NF18404_high_135
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_135 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 26596442 - 26596306
Alignment:
| Q |
1 |
tcagaacgtgtgatcaatttagtaagtataaaaatccaaaactcaaaggaattgtttagagagnnnnnnnntactgattcttggtggctttccatccatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
26596442 |
tcagaacgtgtgatcaatttagtaagtataaaaatccaaaactcaaaggaattgtttagagag-aaaaaaatactgcttcttggtggctttccatccatc |
26596344 |
T |
 |
| Q |
101 |
tatccaaagagatgattaatgatttttaaaatgaagaagaaaagg |
145 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26596343 |
tatccaaagag-------atgatttttaaaatgaagaagaaaagg |
26596306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 163 - 243
Target Start/End: Complemental strand, 26596245 - 26596165
Alignment:
| Q |
163 |
taatggattcattttttaacaaaaagatcatataattaaaattttnnnnnnntcttgatgtctttgacataccctaatatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
26596245 |
taatggattcattttttaacaaaaagatcatataattaaaaattttaaaaaatcttgatgtctttgacataccctaatatt |
26596165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University