View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_138 (Length: 249)
Name: NF18404_high_138
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_138 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 108 - 232
Target Start/End: Complemental strand, 38855503 - 38855379
Alignment:
| Q |
108 |
ctttctttctttgtgtgtttgttgacgtcaaaagtttagaaaattaatgtaggaattaattttgtcgaccttaaggataacnnnnnnnnatatatcaatt |
207 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
38855503 |
ctttctttctttgtgtgtttgttgaggtcaaaagtttagaaaattaatgtaggaattaattttgtcgactttaaggataacttttttttatatatcaatt |
38855404 |
T |
 |
| Q |
208 |
aaaagtccaccagaaatagatctat |
232 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
38855403 |
aaaagtcccccagaaatagatctat |
38855379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 38855660 - 38855614
Alignment:
| Q |
1 |
cacataacaaattagtatatctagtaattt-aaaattaagtttatat |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38855660 |
cacataacaaattagtatatctagtaatttaaaaattaagtttatat |
38855614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University