View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_139 (Length: 249)
Name: NF18404_high_139
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_139 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 249
Target Start/End: Original strand, 32168791 - 32169026
Alignment:
| Q |
14 |
ttctccatttttccacaatataaaagtttgcagtgtaaccgcaatcgcgactgcatttaaaaccatgatgagaaggaagggcttggcacatttgatcata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168791 |
ttctccatttttccacaatataaaagtttgcagtgtaaccgcaatcgcgactgcatttaaaaccatgatgagaaggaagggcttggcacatttgatcata |
32168890 |
T |
 |
| Q |
114 |
gtgaggtttatcaatatgaatccctttgtcaagtggtggattatgggtttgactaaggaaatattaacacttctacannnnnnnnnaattgtaatacaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32168891 |
gtgaggtttatcaatatgaatccctttgtcaagtggtggattatgggtttgactaaggaaatattaacacttctacatttttttttaattgtaatacaca |
32168990 |
T |
 |
| Q |
214 |
cacatgccaagaaaatttccttggttgtgccatttg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168991 |
cacatgccaagaaaatttccttggttgtgccatttg |
32169026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 24913976 - 24913940
Alignment:
| Q |
21 |
tttttccacaatataaaagtttgcagtgtaaccgcaa |
57 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24913976 |
ttttaccacaatataaaagtttgcagtgtaaccgcaa |
24913940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 12155904 - 12155943
Alignment:
| Q |
20 |
atttttccacaatataaaagtttgcagtgtaaccgcaatc |
59 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
12155904 |
attttgccgcaatataaaagtttgcagtgtaaccgcaatc |
12155943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University