View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18404_high_146 (Length: 245)

Name: NF18404_high_146
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18404_high_146
NF18404_high_146
[»] chr5 (3 HSPs)
chr5 (10-232)||(19197441-19197663)
chr5 (125-178)||(19201478-19201531)
chr5 (3-43)||(19201618-19201658)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 19197663 - 19197441
Alignment:
10 agaggccgggtaaaaaatgtagtgggagatgaaaagttgaactttaatttaaaaactaattgcaaacttctaaattgcagaaagaacttgaaaggggaag 109  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
19197663 agaggctgggtaaaaaatgtggtgggagatgaaaagttgaactttaatttaaaaactaattgcaaacttctaaattgcagagtgaacttgaaaggggaag 19197564  T
110 gaagaaatctttggagaagtatgtaaatctagttgcagacggagagatagaaaaggctgaggaaagccgnnnnnnnttgcagagtgaacttgaacgggga 209  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||       ||||||||||||||||||||||||    
19197563 gaagaaatctttggagaagtatgtaaatctagttgcagacggagcgatagccaaggctgaggaaagccgaaaaaaattgcagagtgaacttgaacgggga 19197464  T
210 aagaagaaatcttgggagaaatt 232  Q
    |  |||||||||| |||||||||    
19197463 agtaagaaatcttcggagaaatt 19197441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 19201531 - 19201478
Alignment:
125 gaagtatgtaaatctagttgcagacggagagatagaaaaggctgaggaaagccg 178  Q
    ||||||||||||||||||||||||||| | || ||  |||||||||||||||||    
19201531 gaagtatgtaaatctagttgcagacggcgcgagagccaaggctgaggaaagccg 19201478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 19201658 - 19201618
Alignment:
3 aaactagagaggccgggtaaaaaatgtagtgggagatgaaa 43  Q
    |||||||| |||||||||| |||||||||||||||||||||    
19201658 aaactagaaaggccgggtataaaatgtagtgggagatgaaa 19201618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University