View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_146 (Length: 245)
Name: NF18404_high_146
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_146 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 19197663 - 19197441
Alignment:
| Q |
10 |
agaggccgggtaaaaaatgtagtgggagatgaaaagttgaactttaatttaaaaactaattgcaaacttctaaattgcagaaagaacttgaaaggggaag |
109 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19197663 |
agaggctgggtaaaaaatgtggtgggagatgaaaagttgaactttaatttaaaaactaattgcaaacttctaaattgcagagtgaacttgaaaggggaag |
19197564 |
T |
|
| Q |
110 |
gaagaaatctttggagaagtatgtaaatctagttgcagacggagagatagaaaaggctgaggaaagccgnnnnnnnttgcagagtgaacttgaacgggga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19197563 |
gaagaaatctttggagaagtatgtaaatctagttgcagacggagcgatagccaaggctgaggaaagccgaaaaaaattgcagagtgaacttgaacgggga |
19197464 |
T |
|
| Q |
210 |
aagaagaaatcttgggagaaatt |
232 |
Q |
| |
|
| |||||||||| ||||||||| |
|
|
| T |
19197463 |
agtaagaaatcttcggagaaatt |
19197441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 19201531 - 19201478
Alignment:
| Q |
125 |
gaagtatgtaaatctagttgcagacggagagatagaaaaggctgaggaaagccg |
178 |
Q |
| |
|
||||||||||||||||||||||||||| | || || ||||||||||||||||| |
|
|
| T |
19201531 |
gaagtatgtaaatctagttgcagacggcgcgagagccaaggctgaggaaagccg |
19201478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 19201658 - 19201618
Alignment:
| Q |
3 |
aaactagagaggccgggtaaaaaatgtagtgggagatgaaa |
43 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19201658 |
aaactagaaaggccgggtataaaatgtagtgggagatgaaa |
19201618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University