View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_160 (Length: 234)
Name: NF18404_high_160
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_160 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 105 - 221
Target Start/End: Complemental strand, 5202183 - 5202069
Alignment:
| Q |
105 |
atatatataaataatcactttatttgattcatccagttcaacatcattagttaaaactcgctaattggcaaacataccctggatatatatgaaaacctaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5202183 |
atatatataaataatcactttatttgattcatccagttcaaaatcattagtgaaaactcgctaattggcaaacataccctggat--atatgaaaacctaa |
5202086 |
T |
 |
| Q |
205 |
attacaatataaattat |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5202085 |
attacaatataaattat |
5202069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 5202301 - 5202219
Alignment:
| Q |
1 |
ctaaaaccatacaacaataaagtgtctgtatacatatctcatgacgtaccgcaccgctgtcatcatgttttcactgttcttaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5202301 |
ctaaaaccatacaacaataaagtgtctgtatacatatctcatgacgtaccgcaccgctgtcatcatgttttcactgttcttaa |
5202219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University