View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_171 (Length: 224)
Name: NF18404_high_171
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_171 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 48 - 196
Target Start/End: Complemental strand, 3127783 - 3127632
Alignment:
| Q |
48 |
gagtcagaaaattacaatattgtggcattagtgaagaaagtgtagatttctaacatacactttcataatttct---nnnnnnntttatcaaatgcatata |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3127783 |
gagtcagaaaattacaatattgtggcattagtgaagaaagtgtagatttctaacatacactttcataatttctaaaaaaaaaaaatatcaaatgcatata |
3127684 |
T |
|
| Q |
145 |
aaactcaaactggcatgcaagtttttagaaccggtggtcgaatgtttaatag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3127683 |
aaactcaaactggcatgcaagtttttagaaccggtggttgaatgtttaatag |
3127632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 3127815 - 3127783
Alignment:
| Q |
1 |
acacgtaaaacagaaaagattaggagattattg |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3127815 |
acacgtaaaacagaaaagattaggagattattg |
3127783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University