View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_178 (Length: 213)
Name: NF18404_high_178
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_178 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 68 - 172
Target Start/End: Complemental strand, 45044918 - 45044814
Alignment:
| Q |
68 |
tgtttccattacattgttctatacaacattaagaccattaatgttaattaatccaccgagattaccgactgatagaggcctataaatagtggaggttctc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45044918 |
tgtttccattacattgttctatacaacattaagaccattaatgttaattaatccaccgagattaccgactgatagaggcctataaatagtggaggttctc |
45044819 |
T |
 |
| Q |
168 |
cttcg |
172 |
Q |
| |
|
||||| |
|
|
| T |
45044818 |
cttcg |
45044814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University