View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_181 (Length: 210)
Name: NF18404_high_181
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_181 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 42084064 - 42084241
Alignment:
| Q |
20 |
atgaactaacataagtcaaagcaaaattttgtataaaatgatcgaaaatatgaatcatcaatacttgaaggatttaaacttgagacttggggataaacac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42084064 |
atgaactaacataagtcaaagcaaaattttatataaaatgatcgaaaatatgaaccttcaatacttgaaggatttaaacttgagacttggggataaacac |
42084163 |
T |
|
| Q |
120 |
tcttatctacagtatatgtttagcatgattccaaatgtaatgataatatgtagattgaatgtaaatggactatgaatc |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42084164 |
tcttatctacagtatatgtttagtatgattccaaatgtaataataatatgtagattgaatgtaaacggactatgaatc |
42084241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University