View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_43 (Length: 447)
Name: NF18404_high_43
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 13 - 431
Target Start/End: Complemental strand, 30942536 - 30942120
Alignment:
| Q |
13 |
gaagctcaacctagctagcgtgctagagtggattcaagtcctaaaattcaatatcaccatccaaaataagaaaatgtaaagggtgaacttgtgtggaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942536 |
gaagctcaacctagctagcgtgctagagtggattcaagtcctaaaattcaatatcaccatccaaaataagaaaatgtaaagggtgaacttgtgtggaaga |
30942437 |
T |
|
| Q |
113 |
acttaattaaatgtaaaatgaataggtcttagatcttagtatttaggtataaagtatttataatcaaatcgaaaatgctgttaataaattatttgcaaat |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30942436 |
acttaattaaatgcaaaatgaataggtcttagatcttagtatttaggtataaagtatttataatcaaatcgaaaatgttgttaataaattatttgcaaa- |
30942338 |
T |
|
| Q |
213 |
aagttctagactataaacttattgaaatatgccaaaatttaatacaacattgagagaaggaaaaatgcatacccttcggactgtttaacgtaagtctttt |
312 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30942337 |
-agttctagaccataaacttattgaaataagccaaaatttaatacaacattgagagaaggaaaaatgcatacccttcggactgcgtaacgtaagtctttt |
30942239 |
T |
|
| Q |
313 |
gcaatcaggctcatccggcaaaatctcagttgttgacttcagccggcaaaacccgcaatcaccataagactcttgattaggacacatacacaaaactgca |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942238 |
gcaatcaggctcatccggcaaaatctcagttgttgacttcaggcggcaaaacccgcaatcaccataagactcttgattaggacacatacacaaaactgca |
30942139 |
T |
|
| Q |
413 |
ttctcagatgcattgtatc |
431 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30942138 |
ttctcagatgcattgtatc |
30942120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University