View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_high_98 (Length: 305)
Name: NF18404_high_98
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_high_98 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 20 - 285
Target Start/End: Complemental strand, 44262569 - 44262304
Alignment:
| Q |
20 |
ttggcacagtatatgagattagagtatcaaatgattaagtatcagcattgctttctataaaaaagcaggtcttgttgatcctttcaacactcttcaatct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262569 |
ttggcacagtatatgagattagagtatcaaatgatgaagtatcagcattgctttctataaaaaagcaggtcttgttgatcctttcaacactcttcaatct |
44262470 |
T |
 |
| Q |
120 |
tcatgattgaaaattggcattaggaagtgattcagctcattgtaactggactagcatcaaatgcaactcagatggaaatgtaaagaagcttgatctctct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262469 |
tcatgattgaaaattggcattaggaagtgattcagctcattgtaactggactagcatcaaatgcaactcagatggaaatgtaaagaagcttgatctctct |
44262370 |
T |
 |
| Q |
220 |
cacaagaatctctgtggtacaatatccaatgatatagaaacactttaaagtctaacctctcttagc |
285 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262369 |
cacaagaatctcagtggttcaatatccaatgatatagaaacactttaaagtctaacctctcttagc |
44262304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 154 - 283
Target Start/End: Complemental strand, 39470460 - 39470331
Alignment:
| Q |
154 |
gctcattgtaactggactagcatcaaatgcaactcagatggaaatgtaaagaagcttgatctctctcacaagaatctctgtggtacaatatccaatgata |
253 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||| | ||||| ||| |||| |||||||||||||||||||||||| |||||| | ||||| ||||| |
|
|
| T |
39470460 |
gctcattgtaactggaccggaatcgaatgcaactcggctggaactgtggagaaccttgatctctctcacaagaatctcagtggtatagtatccggtgata |
39470361 |
T |
 |
| Q |
254 |
tagaaacactttaaagtctaacctctctta |
283 |
Q |
| |
|
|| ||| |||| ||| ||| || ||||||| |
|
|
| T |
39470360 |
tacaaagacttcaaaatcttacttctctta |
39470331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 109
Target Start/End: Complemental strand, 39470547 - 39470486
Alignment:
| Q |
46 |
tcaaatgattaagtatcagcattgctttctataaaaaagcaggtcttgttgatcctttcaacac |
109 |
Q |
| |
|
||||||||| |||||||||| ||||||||| | ||| | |||||||||||||||||| ||||| |
|
|
| T |
39470547 |
tcaaatgatgaagtatcagctttgctttctttgaaaga--aggtcttgttgatcctttgaacac |
39470486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 153 - 230
Target Start/End: Original strand, 30087490 - 30087567
Alignment:
| Q |
153 |
agctcattgtaactggactagcatcaaatgcaactcagatggaaatgtaaagaagcttgatctctctcacaagaatct |
230 |
Q |
| |
|
||||||||||||||||||| | || | |||||||||| |||| |||| |||||||| ||||||| |||| |||||| |
|
|
| T |
30087490 |
agctcattgtaactggactggtgtccagtgcaactcagctggagctgtagagaagcttaatctctcacacatgaatct |
30087567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University