View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_124 (Length: 273)
Name: NF18404_low_124
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_124 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 255
Target Start/End: Original strand, 13399027 - 13399263
Alignment:
| Q |
14 |
ttctgttcccaagagtaaacttcaaaagtttagtgacatggacaatttatcttgtgttgtctgcaattttaatttgttttataaaacctagttattgcat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13399027 |
ttctgttcccaagagtaaacttcaaaagtttagtgacttggacaatttatcttgtgttgtctgcaatttt-----gttttataaaacctagttattgcat |
13399121 |
T |
 |
| Q |
114 |
caattttgcagaagaaaccaggtttggaatcacgtgtctttcattaatctgagccgttttaatttgtttacttcaggtgggaaaatatcgttgatcctaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13399122 |
caattttgcagaagaaaccaggtttggaatcacatctctttcattaatctaagccgttttaatttgtttacttcaggtgggaaaatatcgttgatcctaa |
13399221 |
T |
 |
| Q |
214 |
aagtattatcgagttacattatcagatctgtgtagattattc |
255 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13399222 |
aagtactatcgagttacattatcagatctgtgtagattattc |
13399263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University