View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_128 (Length: 270)
Name: NF18404_low_128
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_128 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 46 - 114
Target Start/End: Original strand, 11135753 - 11135820
Alignment:
| Q |
46 |
acagattgaattttctaaaactgattattttnnnnnnntgttgtttgattttgtttttctggtatggtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11135753 |
acagattgaattttctaaaactgattatttt-aaaaaatgttgtttgattttgtttttctggtatggtt |
11135820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11135251 - 11135299
Alignment:
| Q |
1 |
cgacactgacacgcatacacacggacacgattgcatatgtgtctgacag |
49 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11135251 |
cgacactgacatgcatacacactgacacgattgcatatgtgtctgacag |
11135299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 220 - 255
Target Start/End: Original strand, 11135926 - 11135961
Alignment:
| Q |
220 |
agtacagtatggttgagatacttaatggtgaagatt |
255 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11135926 |
agtacagtattgttgagatacttaatggtgaagatt |
11135961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University