View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_133 (Length: 263)
Name: NF18404_low_133
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_133 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 3311124 - 3311257
Alignment:
| Q |
1 |
tactcttaaatgctcctttgcttttcccatttgtgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccctcattctaggatgtttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3311124 |
tactcttaaatgctcctttgcttttcccacttgcgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccatcattctaggttgtttaa |
3311223 |
T |
 |
| Q |
101 |
tgggtgccttttagggtcgtcgatattacataat |
134 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| |
|
|
| T |
3311224 |
tgggtaacttttagggttgtcgatattacataat |
3311257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 113 - 182
Target Start/End: Original strand, 3311280 - 3311348
Alignment:
| Q |
113 |
agggtcgtcgatattacataatcgaaagggttatgttaatcacttgaatgacggagaaatgatatttgta |
182 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
3311280 |
agggttgtcgatattacataattgaaagggttatgttaatcacttaaacgacggagaaat-atatttgta |
3311348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University