View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_139 (Length: 253)
Name: NF18404_low_139
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_139 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 25 - 253
Target Start/End: Complemental strand, 44966598 - 44966378
Alignment:
| Q |
25 |
accaaaatgcaaaaatgttagtcttaannnnnnngatgacaattgacaaatattagatgacccatatttatgatgatctcaaacaaagtatttgtaattc |
124 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44966598 |
accaaaatgcaaaaatgttagtcttaatttttt-gatgacaattgacaaatattagatgacccatatttatgatgatctgaaacaaagtatttgtaattc |
44966500 |
T |
 |
| Q |
125 |
ctctcctctcccggctccccctttgcccttttctccattaaagtatctatttcaaaaagtactagtgagctagtactattaattatgatgattcagatac |
224 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44966499 |
ctctcctctctc-------cctttgcccttttctccattaaagtatctatttcaaaaagaactagtgagctagtactactaattatgatgattcagatac |
44966407 |
T |
 |
| Q |
225 |
atcatacgacattgaagtcatatcaatgc |
253 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
44966406 |
atcatatgacattgaagtcatatcaatgc |
44966378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University