View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_140 (Length: 252)
Name: NF18404_low_140
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_140 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 40783697 - 40783484
Alignment:
| Q |
1 |
taggactataattattgagtatttgtgtctctatttctgtcaaagttaatgaagtgtcaaacaaaatactctaatgaataatttatgtcaagtactctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40783697 |
taggactataattattgagtatttgtgtctctatttctgtcaaagttaatgaagtgtcaaacaaaatactctaatgaataatttatgtcaactactctcc |
40783598 |
T |
 |
| Q |
101 |
ttttgcttataattctcaatattactcaattattgtttacaaaatatatactcaatcattaaacaacaatgatatatgtatatcatttttattctatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783597 |
ttttgcttataattctcaatattactcaattattgtttacgaaatatatactcaatcattaaacaacaatgatatatgtatatcatttttattctatatt |
40783498 |
T |
 |
| Q |
201 |
cattcaacacatca |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40783497 |
tattcaacacatca |
40783484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University