View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18404_low_144 (Length: 250)

Name: NF18404_low_144
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18404_low_144
NF18404_low_144
[»] chr3 (1 HSPs)
chr3 (13-241)||(47892817-47893045)


Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 241
Target Start/End: Original strand, 47892817 - 47893045
Alignment:
13 aaataatgtggataatatccacttatgtgaaaatcttaagagatggaaaatgacatgatgtggtcaaggggcggggtacccttcgtaaaatttggttgtt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47892817 aaataatgtggataatatccacttatgtgaaaatcttaagagatggaaaatgacatgatgtggtcaaggggcggggtacccttcgtaaaatttggttgtt 47892916  T
113 tgaaattgaagtaatgagcaacaaagatggctaagaggggggcatggctatataatagatgaaccgtagacgacaaattagcattaattgctagaaaagt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47892917 tgaaattgaagtaatgagcaacaaagatggctaagaggggggcatggctatataatagatgaaccgtagacgacaaattagcattaattgctagaaaagt 47893016  T
213 actatttccgtcttatattttagtataat 241  Q
    |||||||||||||||||||||||||||||    
47893017 actatttccgtcttatattttagtataat 47893045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University