View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_148 (Length: 249)
Name: NF18404_low_148
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_148 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 52687208 - 52686973
Alignment:
| Q |
14 |
gaacttcccacgtaaacaaagaatgattccttgttgtttgtgttttaagtaaaataaaataacacatgttgattttattcataaatatgacaaagcataa |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52687208 |
gaacttctcacgtaaacaaagaatgattccttgttgtccgtgttttaagtaaaataaaataacacatgttgattttattcataaatatgacaaagcataa |
52687109 |
T |
 |
| Q |
114 |
ccaaaaacacaaatttaccgattgaataactattctcttaaacacaatacacccaagtcttcaaattcatcatatgtgaagttagaaaaacaaattcctt |
213 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52687108 |
ccgaaaacacaaatttaccgattgaagaactattctcttaaacacattacacccaagtcttcaaattcatcatatgtgaagttagaaaaacgaattcctt |
52687009 |
T |
 |
| Q |
214 |
cataaaatttatcccaaaaatatatacaaatgactc |
249 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52687008 |
cgtaaaatttatcccaaaaatatatacaaatgactc |
52686973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University