View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_152 (Length: 247)
Name: NF18404_low_152
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_152 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 85 - 184
Target Start/End: Complemental strand, 27813271 - 27813172
Alignment:
| Q |
85 |
gtttcatgcacatctattaattttgttatatctgttgcaataaatgtttggtgcttcttagtgtgattaagtctttacttgttttaagggttagctgatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27813271 |
gtttcatgcacatctattaattttgttatatctgttgcaataaatgtttggtgcttcttagtgtgattaagtctttacttgttttaagggttagctgatt |
27813172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 12 - 177
Target Start/End: Complemental strand, 3248281 - 3248107
Alignment:
| Q |
12 |
acagaaacaaggacatacgaaaggaatccgagaattgcaaaaggttt--------tctgacatcgaacaccctttttgtgtgtttcatgcacatctatta |
103 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| | || |||| ||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
3248281 |
acagaaacaagaacatacgaaaggaatccgagaattgcaaaaggtttgtcgtcaatttgtcatcaaacacccttgttgtgtgtttcatggacatcaatta |
3248182 |
T |
 |
| Q |
104 |
attttgttatatctgttgcaataaa-tgtttggtgcttcttagtgtgattaagtctttacttgttttaagggtta |
177 |
Q |
| |
|
||||||||||||||||||||||||| | ||| |||||||||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
3248181 |
attttgttatatctgttgcaataaattatttagtgcttcttagtttgattacgtctttacttgttttaagtgtta |
3248107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University