View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_157 (Length: 242)
Name: NF18404_low_157
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_157 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 28471961 - 28471748
Alignment:
| Q |
11 |
catcatcacgatgaatcgttcgactttgttttgtccaaggatttgggaaaagttgctgtccctgcattggttgtccttgaagttgaacgtattctgaaac |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28471961 |
catcaccacgatgaatcgttcgactttgttttgtccaaggatttgggaaaagttgctgtccctgcattggttgtccttgaagttgaacgtattctgaaac |
28471862 |
T |
 |
| Q |
111 |
ctaatggaattggtgctttgcttttggattttgatgacaacgacaacattaacatgataagatatgcttcaccgatttcagcgttgctgcgaaattcatc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28471861 |
ctaatggaattggtgctttgcttttggatttcgatgacaacgacaacattaacatgataagatatgcttcaccgatttcagcgttgctgcgaaattcatc |
28471762 |
T |
 |
| Q |
211 |
tattgttcatgtta |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28471761 |
tattgttcatgtta |
28471748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 66 - 126
Target Start/End: Original strand, 40806240 - 40806300
Alignment:
| Q |
66 |
ctgtccctgcattggttgtccttgaagttgaacgtattctgaaacctaatggaattggtgc |
126 |
Q |
| |
|
|||||||||| ||| |||| ||||| ||||||||| |||| || ||||||||||||||||| |
|
|
| T |
40806240 |
ctgtccctgctttgcttgttcttgaggttgaacgtgttcttaagcctaatggaattggtgc |
40806300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University