View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_158 (Length: 239)
Name: NF18404_low_158
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_158 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 1282552 - 1282328
Alignment:
| Q |
16 |
cactttggataatataaattacattaaaggaatggatgttgatagcaaaagaggggtgtgggtagccctacactggagcttcactctaaagcccacatta |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
1282552 |
cactttggattatataaattacattaaaggaatggatgttgatagcaaaagaggggtgtgggtagcactacaccggagcttcactctaaagcccacatta |
1282453 |
T |
 |
| Q |
116 |
ttattttttgtctttctattttctttcaacaaccaagtnnnnnnnnnngtttattattctcttttaacctaacttcattg--------ctatttctaccc |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1282452 |
ttattttttgtctttctattttctttccacaaccaagtaaaaaaaaatgtttattattctcttttaacctaacttcattgctatttgcctatttctaccc |
1282353 |
T |
 |
| Q |
208 |
aacttaaataaccacaggttctgct |
232 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
1282352 |
aacttaaataaccataggttctgct |
1282328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University