View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_167 (Length: 234)
Name: NF18404_low_167
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_167 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 216
Target Start/End: Complemental strand, 42236673 - 42236468
Alignment:
| Q |
10 |
aagcataggtgaagtagttgttgacaatgacactgcttgagccatggctattacacgtaggaaagtagagtagaaaaaaggatgaagaaatgaaacaatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42236673 |
aagcataggtgaagtagttgttgacaatgacactgcttgagccatggctattatacgtaggaaagtagagtagaaaaa-ggatgaagaaatgaaacaatt |
42236575 |
T |
|
| Q |
110 |
aacaacaaagattagtagcttgctagatagaatcagttgcaattgttgatgataggagtgggaagtgggagttgtgaatatatagagttggtgtgaaagg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42236574 |
aacaacaaagattagtagcttgctagatagaatcagttgcaattgttgatgataggagtgggaagtgagagttgtgaatatatagagttggtgtgaaagg |
42236475 |
T |
|
| Q |
210 |
tggagaa |
216 |
Q |
| |
|
||||||| |
|
|
| T |
42236474 |
tggagaa |
42236468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University