View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18404_low_172 (Length: 232)

Name: NF18404_low_172
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18404_low_172
NF18404_low_172
[»] chr4 (1 HSPs)
chr4 (18-217)||(52029524-52029723)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 52029723 - 52029524
Alignment:
18 aaaatcgatgcaggttcttaattcaggtggttcgggctgttgtttctggtattggagctgaaagagttggtgtcagaatttcaccagcaattgatcacaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52029723 aaaatcgatgcaggttcttaattcaggtggttcgggctgttgtttctggtattggagctgaaagagttggtgtcagaatttcaccagcaattgatcacaa 52029624  T
118 tgatgctattgattctgatccacttggattaggcttagcagtgatcgagagactaaacaatctccaaaaagagcttggtagaaaacttacgtatcttcat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52029623 tgatgctattgattctgatccacttggattaggcttagcagtgattgagagactaaacaatctccaaaaagagcttggtagaaaacttacgtatcttcat 52029524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University