View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_174 (Length: 230)
Name: NF18404_low_174
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_174 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 19 - 106
Target Start/End: Complemental strand, 43119940 - 43119853
Alignment:
| Q |
19 |
caataatatgagttaaatatgatttgttcaaaacccttactctaaaagcatggtgtgcatgatattcagatccccaacttcacattac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43119940 |
caataatatgagttaaatatgatttgttcaaaacccttactctaaaagcatggtgggcatgatattcagatccccaacttcacattac |
43119853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University