View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_182 (Length: 217)
Name: NF18404_low_182
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_182 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 2242368 - 2242185
Alignment:
| Q |
13 |
gagaagaatgtgttaagaatttcacattgaatgagagagcgtttgaagataagtttataagtggaagtaatactcaccgtaggagccgattttataaagt |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | | | ||| |||| ||||| || |
|
|
| T |
2242368 |
gagatgaatgtgttaagaatttcacattgaatgagagagcgtttgaagataagtttataagtggaggtaatactcaacattgaagctgattctataaggt |
2242269 |
T |
 |
| Q |
113 |
tgagttagaattagctaaagctaacatttctttgttaagagctaaaatttccaatacgctaatattgtaactctcaacaacgtc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2242268 |
tgagttagaattagctaaagctaacatttctttgttaagagctaaaattcccaatacgctaatattgtaactctcaacaacgtc |
2242185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University