View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18404_low_189 (Length: 210)

Name: NF18404_low_189
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18404_low_189
NF18404_low_189
[»] chr7 (1 HSPs)
chr7 (20-197)||(42084064-42084241)


Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 42084064 - 42084241
Alignment:
20 atgaactaacataagtcaaagcaaaattttgtataaaatgatcgaaaatatgaatcatcaatacttgaaggatttaaacttgagacttggggataaacac 119  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
42084064 atgaactaacataagtcaaagcaaaattttatataaaatgatcgaaaatatgaaccttcaatacttgaaggatttaaacttgagacttggggataaacac 42084163  T
120 tcttatctacagtatatgtttagcatgattccaaatgtaatgataatatgtagattgaatgtaaatggactatgaatc 197  Q
    ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||    
42084164 tcttatctacagtatatgtttagtatgattccaaatgtaataataatatgtagattgaatgtaaacggactatgaatc 42084241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University