View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_192 (Length: 204)
Name: NF18404_low_192
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_192 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 25 - 189
Target Start/End: Complemental strand, 28406495 - 28406331
Alignment:
| Q |
25 |
ctgatttcaagaagcaagcagaagttgaagagacattagcccatgctcatatagaaacagatacagatgttacaacaaagacgatcacgacgaagggcca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
28406495 |
ctgatttcaagaagcaagcagaagttgaagagacattagcccatgctcatatagaaacagatacagatgttgcaacaaagacgatcacgacaaagggcca |
28406396 |
T |
 |
| Q |
125 |
cgttgagaagtgaatcaagatgacaattattttatgatagaatgtttgctattcaattttgatta |
189 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28406395 |
cgttgagaagtggatcaagatgactattattttatgatagaatgtttgctattcagttttgatta |
28406331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 86
Target Start/End: Original strand, 40984018 - 40984090
Alignment:
| Q |
14 |
gatgaaggtaactgatttcaagaagcaagcagaagttgaagagacattagcccatgctcatatagaaacagat |
86 |
Q |
| |
|
|||||||| || || ||||||||||||| ||||| |||||| || ||| || ||||||||||||||| |||| |
|
|
| T |
40984018 |
gatgaaggaaattgctttcaagaagcaatcagaacttgaagtgatatttgctaatgctcatatagaaatagat |
40984090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University