View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18404_low_84 (Length: 357)
Name: NF18404_low_84
Description: NF18404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18404_low_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 17 - 346
Target Start/End: Complemental strand, 34443443 - 34443114
Alignment:
| Q |
17 |
agttgttgctctaataggtgtagcagttcttgaaggctcttgacttgcaataggtgtcatttcagttcccatgtctctaaaacatattgattgaacatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34443443 |
agttgttgctctaataggtgtagcagttcttgaaggctcttgacttgcaataggtgtcatttcagttcccatgtctctaaaacatattgattgaacatgg |
34443344 |
T |
 |
| Q |
117 |
attgtgtttttgttttctgctaaaaccttactattattattcattctccaaattgattcatcatcacattctaccttcttagagtcttctgcttcatatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34443343 |
attgtgtttttgttttctgctaaaaccttactattattattcattctccaaattgattcatcatcacattctaccttcttagagtcttctgcttcatatt |
34443244 |
T |
 |
| Q |
217 |
cactactagttgttgtcatgaagtcgcggcatccatcatcgtcgtgttcttcctctttttgtggcacaggagctatcaatcttaaatcatctgcatttga |
316 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34443243 |
cactactagttgttgtcatgaagtcgtggcatccatcatcgtcgtgttcttcctctttttgtggcacaggagctatcaatcttaaatcatctgcatttga |
34443144 |
T |
 |
| Q |
317 |
gtttcttggtttactttttgattggccttt |
346 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
34443143 |
gtttcttggtttactttttgattgaccttt |
34443114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University