View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_high_46 (Length: 341)
Name: NF18406_high_46
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_high_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 19 - 334
Target Start/End: Complemental strand, 827178 - 826862
Alignment:
| Q |
19 |
tggtcagtctgcaaagagaatccgtctcagggaggctgtttcaaaggtcaatttcaaataataatgtagtagtcagtgcctttttcatccaagaattgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
827178 |
tggtcagtctgcaaagagaatccgtctcagggaggctgtttcaaaggtcaatttcaaataatagtgtagtagtcagtgcctttttcatccaagaattgtt |
827079 |
T |
|
| Q |
119 |
ttctattctctactaaaccacatgttatgattattttgannnnnnnn-cagggtattgtcaataatgagactcttggttatttcattgggagagtgtatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
827078 |
gtctattctctactaaaccacatgttatgattattttgatttttttttcagggtattgtcaataatgagactcttggttatttcattgggagagtgtatc |
826979 |
T |
|
| Q |
218 |
tcttcttgatgcgtctcggtatagacaaagaccgcttgagatttaggcagcatcttgccaatgagatggcccattatgccgctgactgttgggatgctga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
826978 |
tcttcttgatgcgtctcggtatagacaaagaccgcttgagatttaggcagcatcttgccaatgagatggcccattatgccgctgactgttgggatgctga |
826879 |
T |
|
| Q |
318 |
gattgagtgctcctatg |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
826878 |
gattgagtgctcctatg |
826862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 167 - 334
Target Start/End: Complemental strand, 833613 - 833446
Alignment:
| Q |
167 |
agggtattgtcaataatgagactcttggttatttcattgggagagtgtatctcttcttgatgcgtctcggtatagacaaagaccgcttgagatttaggca |
266 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
833613 |
agggtattgttaataatgagactcttggttatttcattgggagagtatatctcttcttgacgcgtctcagtatagacaaagaccgcttgagatttaggca |
833514 |
T |
|
| Q |
267 |
gcatcttgccaatgagatggcccattatgccgctgactgttgggatgctgagattgagtgctcctatg |
334 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
833513 |
gcatcttgccaatgagatggctcattatgccgctgactgttgggatgctgagattgagtgttcctatg |
833446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 833730 - 833674
Alignment:
| Q |
19 |
tggtcagtctgcaaagagaatccgtctcagggaggctgtttcaaaggtcaatttcaa |
75 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
833730 |
tggtcagtctgcaaagaaaatccgtcttggggaagctgtttcaaaggtcagtttcaa |
833674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 124 - 334
Target Start/End: Complemental strand, 939881 - 939671
Alignment:
| Q |
124 |
ttctctactaaaccacatgttatgattattttgannnnnnnncagggtattgtcaataatgagactcttggttatttcattgggagagtgtatctcttct |
223 |
Q |
| |
|
|||| ||||||||| |||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
939881 |
ttctttactaaaccgcatgttatgattgttttgatttttgatcagggtattgtcaacaatgagactcttggttatttcattgggagagtatatctcttct |
939782 |
T |
|
| Q |
224 |
tgatgcgtctcggtatagacaaagaccgcttgagatttaggcagcatcttgccaatgagatggcccattatgccgctgactgttgggatgctgagattga |
323 |
Q |
| |
|
||| |||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
939781 |
tgacgcgtctcggtatagacaaagaccgtttaagattcaggcagcatcttgccaatgagatggctcattatgctgctgactgttgggatgctgagattga |
939682 |
T |
|
| Q |
324 |
gtgctcctatg |
334 |
Q |
| |
|
||| ||||||| |
|
|
| T |
939681 |
gtgttcctatg |
939671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 939994 - 939933
Alignment:
| Q |
19 |
tggtcagtctgcaaagagaatccgtctcagggaggctgtttcaaaggtcaatttcaaataata |
81 |
Q |
| |
|
|||||||||||||||||||||||| ||| | || |||||||| ||||||| |||| ||||||| |
|
|
| T |
939994 |
tggtcagtctgcaaagagaatccgcctcggtgatgctgtttcgaaggtcagtttc-aataata |
939933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University