View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18406_high_63 (Length: 298)

Name: NF18406_high_63
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18406_high_63
NF18406_high_63
[»] chr6 (2 HSPs)
chr6 (1-147)||(33758738-33758884)
chr6 (184-280)||(33758604-33758700)
[»] chr5 (1 HSPs)
chr5 (204-271)||(4483918-4483985)
[»] chr2 (1 HSPs)
chr2 (212-253)||(42960706-42960747)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 33758884 - 33758738
Alignment:
1 ttaccgatctgcgatctctatagtcaatgcaccagtgtttcccaaatgcttcccaaattttactctcaaaatctcgcatcggcaaatccttcaagcttct 100  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
33758884 ttaccgatcggcgatctctatagtcaatgcaccagtgtttcccaaaagcttcccaaattttactctcaaaatctcgcatcggcaaatccttcaagcttct 33758785  T
101 aacatattcagccgtcacaaccttttcaatactctctctgtaacaca 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
33758784 aacatattcagccgtcacaaccttttcaatactctctctgtaacaca 33758738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 184 - 280
Target Start/End: Complemental strand, 33758700 - 33758604
Alignment:
184 gttttaagagttatgctatttgacatcgaattttgacaacaaattacatggttaacctagttcaaatatgtcgttaattatattcagtagctggtta 280  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33758700 gttttaagagttatgctatttgacatcgaattttgacaaaaaattacatggttaacctagttcaaatatgtcgttaattatattcagtagctggtta 33758604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 204 - 271
Target Start/End: Original strand, 4483918 - 4483985
Alignment:
204 tgacatcgaattttgacaacaaattacatggttaacctagttcaaatatgtcgttaattatattcagt 271  Q
    ||||||| |||||||||||||| | |||||||||||  ||||||||| ||| | ||||||| ||||||    
4483918 tgacatcaaattttgacaacaattgacatggttaacacagttcaaatgtgtggctaattatgttcagt 4483985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 253
Target Start/End: Complemental strand, 42960747 - 42960706
Alignment:
212 aattttgacaacaaattacatggttaacctagttcaaatatg 253  Q
    ||||| |||||||||||| ||||||||| |||||||||||||    
42960747 aatttcgacaacaaattagatggttaacatagttcaaatatg 42960706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University