View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_high_63 (Length: 298)
Name: NF18406_high_63
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_high_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 33758884 - 33758738
Alignment:
| Q |
1 |
ttaccgatctgcgatctctatagtcaatgcaccagtgtttcccaaatgcttcccaaattttactctcaaaatctcgcatcggcaaatccttcaagcttct |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758884 |
ttaccgatcggcgatctctatagtcaatgcaccagtgtttcccaaaagcttcccaaattttactctcaaaatctcgcatcggcaaatccttcaagcttct |
33758785 |
T |
 |
| Q |
101 |
aacatattcagccgtcacaaccttttcaatactctctctgtaacaca |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758784 |
aacatattcagccgtcacaaccttttcaatactctctctgtaacaca |
33758738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 184 - 280
Target Start/End: Complemental strand, 33758700 - 33758604
Alignment:
| Q |
184 |
gttttaagagttatgctatttgacatcgaattttgacaacaaattacatggttaacctagttcaaatatgtcgttaattatattcagtagctggtta |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758700 |
gttttaagagttatgctatttgacatcgaattttgacaaaaaattacatggttaacctagttcaaatatgtcgttaattatattcagtagctggtta |
33758604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 204 - 271
Target Start/End: Original strand, 4483918 - 4483985
Alignment:
| Q |
204 |
tgacatcgaattttgacaacaaattacatggttaacctagttcaaatatgtcgttaattatattcagt |
271 |
Q |
| |
|
||||||| |||||||||||||| | ||||||||||| ||||||||| ||| | ||||||| |||||| |
|
|
| T |
4483918 |
tgacatcaaattttgacaacaattgacatggttaacacagttcaaatgtgtggctaattatgttcagt |
4483985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 253
Target Start/End: Complemental strand, 42960747 - 42960706
Alignment:
| Q |
212 |
aattttgacaacaaattacatggttaacctagttcaaatatg |
253 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
42960747 |
aatttcgacaacaaattagatggttaacatagttcaaatatg |
42960706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University