View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_high_81 (Length: 243)
Name: NF18406_high_81
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_high_81 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 2257841 - 2257609
Alignment:
| Q |
18 |
attggaactgcaatttgatttggataaaagcttctatatgatcaatggaaaatgaatcttttttctatattaaattctgtttaatt--gtccnnnnnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2257841 |
attggaactgcaatttgatttggataaaagcttctatatgatcaatggaaaatgaatcttttttctatattaaattctgtttaattttgtcctgtttttt |
2257742 |
T |
|
| Q |
116 |
nnnngtt-----gcttatttcttttatgttatataataaaataaatttagtttgattcatgttcgctgtgtatgaaaaatcatatatcggaatatgtcaa |
210 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2257741 |
ttttgttattttgcttatttcttttatgttatataataaaataaatttagtttgattcatgttcgctgtgtatgaaaaatcatatatcggaatatgtcaa |
2257642 |
T |
|
| Q |
211 |
cctttaaataaatctcagttattttaagagatt |
243 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||| |
|
|
| T |
2257641 |
cccttaaataaatctcaattattttaagagatt |
2257609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University