View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18406_high_82 (Length: 242)

Name: NF18406_high_82
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18406_high_82
NF18406_high_82
[»] chr1 (1 HSPs)
chr1 (1-226)||(35338281-35338506)


Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 35338281 - 35338506
Alignment:
1 aaaatgcaacaatgattgaagaggaaaaagaaaatagaatgtatttgaatgaattctcaccaggggcaatgtagccataagaaccaacaacagcagacat 100  Q
    |||||||||||||||||||||| |||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
35338281 aaaatgcaacaatgattgaagatgaaaaataaaatagaatgtgtttggatgaattctcaccaggggcaatgtagccataagaaccaacaacagcagacat 35338380  T
101 tgatttagaccttgagatatcaactagcttagccaaaccaaaatcaccaacatgagcttcaaattcatggtcaataagtatgttattggacttgatatca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35338381 tgatttagaccttgagatatcaactagcttagccaaaccaaaatcaccaacatgagcttcaaattcatggtcaataagtatgttattggacttgatatca 35338480  T
201 cggtggataattctaggcttgcaatc 226  Q
    ||||||||||||||||||||||||||    
35338481 cggtggataattctaggcttgcaatc 35338506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University